Supplemental Information MicroRNA Function Is Globally Suppressed in Mouse Oocytes and Early Embryos

The Dgcr8 delta/flox mice were crossed to Zp3-Cre [1] mice and resulting offsprings were intercrossed to produce Dgcr8 ;Zp3-Cre animals. The following primers were used to genotype mice and the oocytes; P1 5’ primer, TTTCCAACCCAAGTCAGCAGAT ;P1 3’ primer, AGTGCATGTGCCATGCTGCCA; P2 5’ primer, CTGGAGTAGGCATGTTGATTTC; P2 3’ primer, CCTGATTCACTTACAACACAACC; P3 3’ primer, TAAAGCGTCCACATCATTGTC. To determine brood size, Dgcr8 ;Zp3-Cre or control females were bred with several wild type males. The control mice we used are littermates with the genotype of Dgcr8;Zp3-Cre, Dgcr8, Dgcr8 . Fully grown GV-intact cumulusenclosed oocytes were obtained as previously described [2] from PMSG-primed, 4 to 6-week-old females in MEM medium with 5 uM Cilostamide to prevent resumption of meiosis during isolation. For spontaneous maturation, oocytes were allowed to mature in Cilostamide-free medium in an atmosphere of 5% CO2 in air at 37 °C for 8 h (MI oocyte) or 16 h (MII oocyte). Meiosis II oocytes were collected 14-16 hour post hCG injection from females previously primed with PMSG. Zygotes were obtained from the primed females mated to males after 18-20 hours post hCG stimulation. Embryos were then cultured in EmbryoMax KSOM medium (Millipore) in an atmosphere of 5% CO2 in air at 37 °C until blastocysts stages.